Test | Status | Code Input and Output |
---|---|---|
1 | Pass |
s = 'AACTGAACG';
n = 3;
hifreq_correct = 'AAC';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.]
[> In unix (line 32)
In nGramFrequency (line 2)
In ScoringEngineTestPoint1 (line 4)
In solutionTest (line 3)]
|
2 | Pass |
s = 'dynamic routing service';
n = 2;
hifreq_correct = 'ic';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.]
[> In unix (line 32)
In nGramFrequency (line 2)
In ScoringEngineTestPoint2 (line 4)
In solutionTest (line 5)]
|
3 | Pass |
s = 'Your veracity is exceeded by your sagacity.';
n = 5;
hifreq_correct = 'acity';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.]
[> In unix (line 32)
In nGramFrequency (line 2)
In ScoringEngineTestPoint3 (line 4)
In solutionTest (line 7)]
|
4 | Pass |
s = 'AGCGAAGGAAGGATCACATTTCTCAGGACAAAGGCATTTCACTAATGGTT';
n = 3;
hifreq_correct = 'AGG';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.]
[> In unix (line 32)
In nGramFrequency (line 2)
In ScoringEngineTestPoint4 (line 4)
In solutionTest (line 9)]
|
5 | Pass |
s = 'In short, in matters vegetable, animal, and mineral, I am the very model of a modern Major-General.';
n = 2;
hifreq_correct = 'er';
assert(isequal(nGramFrequency(s,n),hifreq_correct))
[Warning: Function assert has the same name as a MATLAB builtin. We suggest you rename the function to avoid a potential name conflict.]
[> In unix (line 32)
In nGramFrequency (line 2)
In ScoringEngineTestPoint5 (line 4)
In solutionTest (line 11)]
|
9873 Solvers
Return the 3n+1 sequence for n
6168 Solvers
Find perfect placement of non-rotating dominoes (easier)
240 Solvers
282 Solvers
406 Solvers
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!