Statistics
RANK
132,001
of 300,343
REPUTATION
0
CONTRIBUTIONS
3 Questions
2 Answers
ANSWER ACCEPTANCE
0.0%
VOTES RECEIVED
0
RANK
of 20,926
REPUTATION
N/A
AVERAGE RATING
0.00
CONTRIBUTIONS
0 Files
DOWNLOADS
0
ALL TIME DOWNLOADS
0
RANK
of 168,172
CONTRIBUTIONS
0 Problems
0 Solutions
SCORE
0
NUMBER OF BADGES
0
CONTRIBUTIONS
0 Posts
CONTRIBUTIONS
0 Public Channels
AVERAGE RATING
CONTRIBUTIONS
0 Highlights
AVERAGE NO. OF LIKES
Feeds
Question
how to find accuracy from confusion matrix having 4 x4 dimensions
I have used the following function for finding confusion matrix c=confusionmat(x,y) it gives me output like that , C = ...
6 years ago | 0 answers | 0
0
answersQuestion
Pleas tell me how to solve the Error in the Code?
this given below is the code if Interior Search Algorith with Back propagation i want results like this Epoch=1 Time=1.40838 ...
6 years ago | 0 answers | 0
0
answersQuestion
Window length Selection size for DNA sequence?
i have a DNA sequence like ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 s...
6 years ago | 0 answers | 0
0
answersHow to decide window size for a moving average filter?
How can we select a wind size for the selection of DNA sequence like ATCGGGCTTACGG window length size 5 to read the sequence...
6 years ago | 0
Decoding DNA sequence into binary
Please also write code for DNA sequencig in 4 bits via this given schema 4 2 1 0 N = 0 0 0 1 N repre...
7 years ago | 0
