
Find palindromes in sequence


[Position, Length] = palindromes(SeqNT)
[Position, Length, Pal] = palindromes(SeqNT)
... = palindromes(SeqNT, ..., 'Length', LengthValue, ...)
... = palindromes(SeqNT, ..., 'Complement', ComplementValue, ...)



One of the following:

LengthValueInteger specifying a minimum length for palindromes. Default is 6.
ComplementValueControls the return of complementary palindromes, that is, where the elements match their complementary pairs A-T (or U) and C-G instead of an exact nucleotide match. Choices are true or false (default).


[Position, Length] = palindromes(SeqNT) finds all palindromes in sequence SeqNT with a length greater than or equal to 6, and returns the starting indices, Position, and the lengths of the palindromes, Length.

[Position, Length, Pal] = palindromes(SeqNT) also returns a cell array, Pal, of the palindromes.

... = palindromes(SeqNT, ...'PropertyName', PropertyValue, ...) calls palindromes with optional properties that use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows:

... = palindromes(SeqNT, ..., 'Length', LengthValue, ...) finds all palindromes longer than or equal to LengthValue. Default is 6.

... = palindromes(SeqNT, ..., 'Complement', ComplementValue, ...) controls the return of complementary palindromes, that is, where the elements match their complementary pairs A-T (or A-U) and C-G instead of an exact nucleotide match. Choices for ComplementValue are true or false (default).


Find the palindromes in a simple nucleotide sequence.

[p,l,s] = palindromes('GCTAGTAACGTATATATAAT')

p =
l =
s = 

Find the complementary palindromes in a simple nucleotide sequence.

[pc,lc,sc] = palindromes('TAGCTTGTCACTGAGGCCA',...
pc =
lc =
sc = 

Find the palindromes in a random nucleotide sequence.

a = randseq(100)

a =


pos =
len =
pal = 

Introduced before R2006a