How do I generate a random dna sequence without specific codons?

Hi all,
I am trying to figure out how to use randseq to generate a random dna sequence that excludes stop codons TAG, TAA, and TGA. I think it has to do with 'Case', but I am having difficulty finding information elsewhere.
Thank you!

Answers (1)

randseq function does not have the option to exclude stop codons. The following is one possible solution to generate random sequence without stop codons.
% List of all possible combination
C = {'A','T','G','C'};
[x,y,z] = meshgrid(C,C,C);
list = strcat(x(:), y(:), z(:));
% Delete stop codons from the list
idx = ismember(list,{'TAG','TAA','TGA'});
list(idx) = [];
% Generate random sequence with N codons
N = 10;
idx = randi([1 numel(list)],1,N);
randSeq = [list{idx}];
The result is:
>> randSeq
randSeq =
'TGCATTTACAATGCCTCTCTAATTGAGCGT'

1 Comment

More simple solution is to use randseq function and erase stop codons, like the following. But please note that this solution can not guarantee the output sequence length.
% Generate random sequence
randSeq = randseq(60);
% Erase stop codons
randSeq = erase(randSeq,{'TAG','TAA','TGA'});

Sign in to comment.

Categories

Find more on Genomics and Next Generation Sequencing in Help Center and File Exchange

Asked:

on 6 Mar 2018

Commented:

on 7 Mar 2018

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!