DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show comments
Loading...
Problem Recent Solvers4
Suggested Problems
-
2370 Solvers
-
Find perfect placement of non-rotating dominoes (easier)
389 Solvers
-
Create incremental spiral WITHOUT USING EVAL or FEVAL
47 Solvers
-
60 Solvers
-
Calculate the Number of Sign Changes in a Row Vector (No Element Is Zero)
967 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
