Problem 912. Genome Sequence 002: Introductory DNA Sequencing (Flipped Segments)

Created by Richard Zapor

Solve Later

{"parts":[{"partUri":"/matlab/document.xml","contentType":"application/vnd.mathworks.matlab.code.document+xml","content":"<?xml version=\"1.0\" encoding=\"UTF-8\"?><w:document xmlns:w=\"http://schemas.openxmlformats.org/wordprocessingml/2006/main\"><w:body><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>This Challenge series will evolve the complexity of Genome DNA Sequencing.</w:t></w:r><w:r><w:t> </w:t></w:r><w:hyperlink w:docLocation=\"\"><w:r><w:t>DNA Sequencing</w:t></w:r></w:hyperlink><w:r><w:t> and the</w:t></w:r><w:r><w:t> </w:t></w:r><w:hyperlink w:docLocation=\"\"><w:r><w:t>Shot Gun Method</w:t></w:r></w:hyperlink><w:r><w:t> will be naively simplified into Cody Challenges.</w:t></w:r><w:r><w:t> </w:t></w:r><w:hyperlink w:docLocation=\"\"><w:r><w:t>Genome sizes</w:t></w:r></w:hyperlink><w:r><w:t> is another interesting wiki page.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments. Segments are gleaned from multiple copies of the Virus/Bacteria/Chromosome thus there are overlapping, duplicative, and flipped segments. There are potential errors and duplicative stretches in the created segments. Chromosome 20 in its 59,187,298 base pairs has a segment of 820 that is repeated in at least two locations. The data being non-random largely increase lengths of duplicative stretches.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Example:</w:t></w:r><w:r><w:t> Genome = ACGTCGGCCATGGACATTACG</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Given three overlapping pieces, ACGTCGGCCA,TACAGGTACCGG, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as being flipped left-right.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"code\"/></w:pPr><w:r><w:t><![CDATA[ACGTCGGCCATGGACATTACG\nACGTCGGCCAsssssssssss\nsssssTACAGGTACCGGssss Middle\nsssssGGCCATGGACATssss Middle Reversed\nssssssssssssGACATTACG]]></w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Genome_002 Challenge is to reconstruct a genome under near ideal segment creation conditions. Some of the segments will be reversed. The output may be reversed.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Segments may be flipped (Genome_002 change)</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Length of each segment - 48</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Segments begin at locations 1, 33, 65,...32N+1 (N=0:K, L_Genome=32K+48)</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>All segments are provided once (Essentially two copies of a genome were cut into pieces with overlaps)</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>No errors in the segments</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Genome is random (No duplicate starts or ends for 16 symbols of segments)</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Segment order will be scrambled</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Input:</w:t></w:r><w:r><w:t> segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Output:</w:t></w:r><w:r><w:t> Gout, Genome or fliplr(Genome) vector of values [0,1,2,3]</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Example:</w:t></w:r><w:r><w:t> [0 1 2 2; 1 3 2 2; 3 1 1 2] creates [0 1 2 2 3 1 1 2] M=3,W=4, Overlap=2; Middle segment was flipped</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Future:</w:t></w:r><w:r><w:t> Flipped segments(002), Random Position of Segment start locations, Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments</w:t></w:r></w:p></w:body></w:document>","relationship":null}],"relationships":[{"relationshipType":"http://schemas.mathworks.com/matlab/code/2013/relationships/document","target":"/matlab/document.xml","relationshipId":"rId1"}]}

<div style = "text-align: start; line-height: 20.4333px; min-height: 0px; white-space: normal; color: rgb(0, 0, 0); font-family: Menlo, Monaco, Consolas, monospace; font-style: normal; font-size: 14px; font-weight: 400; text-decoration: rgb(0, 0, 0); white-space: normal; "><div style="block-size: 727.2px; display: block; min-width: 0px; padding-block-start: 0px; padding-top: 0px; perspective-origin: 407px 363.6px; transform-origin: 407px 363.6px; vertical-align: baseline; "><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 243px 8px; transform-origin: 243px 8px; unicode-bidi: normal; "><span style="">This Challenge series will evolve the complexity of Genome DNA Sequencing.</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> </span></span><a target='_blank' href = "/#null"><span style=""><span style="">DNA Sequencing</span></span></a><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 26px 8px; transform-origin: 26px 8px; unicode-bidi: normal; "><span style=""> and the</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> </span></span><a target='_blank' href = "/#null"><span style=""><span style="">Shot Gun Method</span></span></a><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> will be naively simplified into Cody Challenges.</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> </span></span><a target='_blank' href = "/#null"><span style=""><span style="">Genome sizes</span></span></a><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 101.5px 8px; transform-origin: 101.5px 8px; unicode-bidi: normal; "><span style=""> is another interesting wiki page.</span></span></div><div style="block-size: 105px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 52.5px; text-align: left; transform-origin: 384px 52.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 369px 8px; transform-origin: 369px 8px; unicode-bidi: normal; "><span style="">DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments. Segments are gleaned from multiple copies of the Virus/Bacteria/Chromosome thus there are overlapping, duplicative, and flipped segments. There are potential errors and duplicative stretches in the created segments. Chromosome 20 in its 59,187,298 base pairs has a segment of 820 that is repeated in at least two locations. The data being non-random largely increase lengths of duplicative stretches.</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 31.5px 8px; transform-origin: 31.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Example:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 139px 8px; transform-origin: 139px 8px; unicode-bidi: normal; "><span style=""> Genome = ACGTCGGCCATGGACATTACG</span></span></div><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 367px 8px; transform-origin: 367px 8px; unicode-bidi: normal; "><span style="">Given three overlapping pieces, ACGTCGGCCA,TACAGGTACCGG, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as being flipped left-right.</span></span></div><div style="background-color: rgb(247, 247, 247); block-size: 102.167px; border-bottom-left-radius: 4px; border-bottom-right-radius: 4px; border-end-end-radius: 4px; border-end-start-radius: 4px; border-start-end-radius: 4px; border-start-start-radius: 4px; border-top-left-radius: 4px; border-top-right-radius: 4px; margin-block-end: 10px; margin-block-start: 10px; margin-bottom: 10px; margin-inline-end: 3px; margin-inline-start: 3px; margin-left: 3px; margin-right: 3px; margin-top: 10px; perspective-origin: 404px 51.0833px; transform-origin: 404px 51.0833px; margin-left: 3px; margin-top: 10px; margin-bottom: 10px; margin-right: 3px; "><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ACGTCGGCCATGGACATTACG</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ACGTCGGCCAsssssssssss</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 112px 8.5px; transform-origin: 112px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; perspective-origin: 88px 8.5px; transform-origin: 88px 8.5px; ">sssssTACAGGTACCGGssss </span><span style="border-block-end-color: rgb(170, 4, 249); border-block-start-color: rgb(170, 4, 249); border-bottom-color: rgb(170, 4, 249); border-inline-end-color: rgb(170, 4, 249); border-inline-start-color: rgb(170, 4, 249); border-left-color: rgb(170, 4, 249); border-right-color: rgb(170, 4, 249); border-top-color: rgb(170, 4, 249); caret-color: rgb(170, 4, 249); color: rgb(170, 4, 249); column-rule-color: rgb(170, 4, 249); margin-inline-end: 0px; margin-right: 0px; outline-color: rgb(170, 4, 249); perspective-origin: 24px 8.5px; text-decoration: none; text-decoration-color: rgb(170, 4, 249); text-emphasis-color: rgb(170, 4, 249); transform-origin: 24px 8.5px; ">Middle</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 148px 8.5px; transform-origin: 148px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; perspective-origin: 88px 8.5px; transform-origin: 88px 8.5px; ">sssssGGCCATGGACATssss </span><span style="border-block-end-color: rgb(170, 4, 249); border-block-start-color: rgb(170, 4, 249); border-bottom-color: rgb(170, 4, 249); border-inline-end-color: rgb(170, 4, 249); border-inline-start-color: rgb(170, 4, 249); border-left-color: rgb(170, 4, 249); border-right-color: rgb(170, 4, 249); border-top-color: rgb(170, 4, 249); caret-color: rgb(170, 4, 249); color: rgb(170, 4, 249); column-rule-color: rgb(170, 4, 249); margin-inline-end: 0px; margin-right: 0px; outline-color: rgb(170, 4, 249); perspective-origin: 60px 8.5px; text-decoration: none; text-decoration-color: rgb(170, 4, 249); text-emphasis-color: rgb(170, 4, 249); transform-origin: 60px 8.5px; ">Middle Reversed</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ssssssssssssGACATTACG</span></span></div></div><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 10px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 10px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 10px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 384px 8px; transform-origin: 384px 8px; unicode-bidi: normal; "><span style="">Genome_002 Challenge is to reconstruct a genome under near ideal segment creation conditions. Some of the segments will be reversed. The output may be reversed.</span></span></div><ol style="block-size: 143.033px; counter-reset: list-item 0; font-family: Helvetica, Arial, sans-serif; list-style-type: decimal; margin-block-end: 20px; margin-block-start: 10px; margin-bottom: 20px; margin-top: 10px; perspective-origin: 391px 71.5167px; transform-origin: 391px 71.5167px; margin-top: 10px; margin-bottom: 20px; "><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 155px 8px; transform-origin: 155px 8px; unicode-bidi: normal; "><span style="">Segments may be flipped (Genome_002 change)</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 91px 8px; transform-origin: 91px 8px; unicode-bidi: normal; "><span style="">Length of each segment - 48</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 241px 8px; transform-origin: 241px 8px; unicode-bidi: normal; "><span style="">Segments begin at locations 1, 33, 65,...32N+1 (N=0:K, L_Genome=32K+48)</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 324px 8px; transform-origin: 324px 8px; unicode-bidi: normal; "><span style="">All segments are provided once (Essentially two copies of a genome were cut into pieces with overlaps)</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 81.5px 8px; transform-origin: 81.5px 8px; unicode-bidi: normal; "><span style="">No errors in the segments</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 240px 8px; transform-origin: 240px 8px; unicode-bidi: normal; "><span style="">Genome is random (No duplicate starts or ends for 16 symbols of segments)</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 102.5px 8px; transform-origin: 102.5px 8px; unicode-bidi: normal; "><span style="">Segment order will be scrambled</span></span></li></ol><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 20px 8px; transform-origin: 20px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Input:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 213px 8px; transform-origin: 213px 8px; unicode-bidi: normal; "><span style=""> segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 26px 8px; transform-origin: 26px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Output:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 184px 8px; transform-origin: 184px 8px; unicode-bidi: normal; "><span style=""> Gout, Genome or fliplr(Genome) vector of values [0,1,2,3]</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 31.5px 8px; transform-origin: 31.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Example:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 317px 8px; transform-origin: 317px 8px; unicode-bidi: normal; "><span style=""> [0 1 2 2; 1 3 2 2; 3 1 1 2] creates [0 1 2 2 3 1 1 2] M=3,W=4, Overlap=2; Middle segment was flipped</span></span></div><div style="block-size: 63px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 31.5px; text-align: left; transform-origin: 384px 31.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 25.5px 8px; transform-origin: 25.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Future:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 354px 8px; transform-origin: 354px 8px; unicode-bidi: normal; "><span style=""> Flipped segments(002), Random Position of Segment start locations, Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments</span></span></div></div></div>

This Challenge series will evolve the complexity of Genome DNA Sequencing. DNA Sequencing and the Shot Gun Method will be naively simplified into Cody Challenges. Genome sizes is another interesting wiki page.
DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments. Segments are gleaned from multiple copies of the Virus/Bacteria/Chromosome thus there are overlapping, duplicative, and flipped segments. There are potential errors and duplicative stretches in the created segments. Chromosome 20 in its 59,187,298 base pairs has a segment of 820 that is repeated in at least two locations. The data being non-random largely increase lengths of duplicative stretches.
Example: Genome = ACGTCGGCCATGGACATTACG
Given three overlapping pieces, ACGTCGGCCA,TACAGGTACCGG, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as being flipped left-right.
ACGTCGGCCATGGACATTACG
ACGTCGGCCAsssssssssss
sssssTACAGGTACCGGssss Middle
sssssGGCCATGGACATssss Middle Reversed
ssssssssssssGACATTACG
Genome_002 Challenge is to reconstruct a genome under near ideal segment creation conditions. Some of the segments will be reversed. The output may be reversed.
Segments may be flipped (Genome_002 change)
Length of each segment - 48
Segments begin at locations 1, 33, 65,...32N+1 (N=0:K, L_Genome=32K+48)
All segments are provided once (Essentially two copies of a genome were cut into pieces with overlaps)
No errors in the segments
Genome is random (No duplicate starts or ends for 16 symbols of segments)
Segment order will be scrambled
Input: segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].
Output: Gout, Genome or fliplr(Genome) vector of values [0,1,2,3]
Example: [0 1 2 2; 1 3 2 2; 3 1 1 2] creates [0 1 2 2 3 1 1 2] M=3,W=4, Overlap=2; Middle segment was flipped
Future: Flipped segments(002), Random Position of Segment start locations, Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments

Solve

Solution Stats

10 Solutions
5 Solvers

Last Solution submitted on Jul 16, 2021

Last 200 Solutions

Problem Comments

1 Comment

1 Comment

Are Mjaavatten on 19 Jul 2021

Be aware that one or more test cases are not shown on the "Solve" page, These may have different values for the parameter L.

Problem Recent Solvers5

Problem Tags

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Problem 912. Genome Sequence 002: Introductory DNA Sequencing (Flipped Segments)

Solution Stats

Last 200 Solutions

Problem Comments

Problem Recent Solvers5

Suggested Problems

More from this Author255

Problem Tags

Community Treasure Hunt

Problem 912. Genome Sequence 002: Introductory DNA Sequencing (Flipped Segments)

Solution Stats

Last 200 Solutions

Problem Comments

Problem Recent Solvers5

Suggested Problems

More from this Author255

Problem Tags

Community Treasure Hunt

Players